SGN Marker solcap_snp_sl_100460

SGN-M18015

Synonyms  
CL016761-0264
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54346)
Chromosome
4
Position
1.97 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CTTCTTCTAAATTCTACTTTTTGTTTCANTTCTTGAAGTAAAAGGCAAAAAAGTAGCAAAAANCAACAAAAACTAAGTGTAAAGTTGTAGTCTTTGTAGT
  
3' flanking region
GGTACTCTAGTGGGTGTGGTGAGAATTGAGGTTCTTGGTGTTTGGGAACTTCAGATCTGATGGGAAGAACAAGTGTTGCTGATGATNTCATGGTCATTTC
SNP nucleotide
AT
SNPdb format
CTTCTTCTAAATTCTACTTTTTGTTTCANTTCTTGAAGTAAAAGGCAAAAAAGTAGCAAAAANCAACAAAAACTAAGTGTAAAGTTGTAGTCTTTGTAGT[A/T]
GGTACTCTAGTGGGTGTGGTGAGAATTGAGGTTCTTGGTGTTTGGGAACTTCAGATCTGATGGGAAGAACAAGTGTTGCTGATGATNTCATGGTCATTTC
  
Genomic location of solcap_snp_sl_100460  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18015 marker 18015
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)