SGN Marker solcap_snp_sl_100624

SGN-M18167

Synonyms  
CL017725-0420
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54498)
Chromosome
3
Position
53.33 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TTTGTGCGAACCCGTGACTGGCAGGACACATCAGGTAATTAAAATGTGATTTTTTACAATTTTCTCGTATCATTTATGTCCACTCTTTAGTCTTTCCTCA
  
3' flanking region
CTAATTCAAAAGAGACACCTTTTTGCATTTTGTTGAAGATCTCTTTGCTCTTTATTTATATANTTTTTGAGTTGAATAATCTTTNTGCCCGAGTTATACC
SNP nucleotide
AT
SNPdb format
TTTGTGCGAACCCGTGACTGGCAGGACACATCAGGTAATTAAAATGTGATTTTTTACAATTTTCTCGTATCATTTATGTCCACTCTTTAGTCTTTCCTCA[A/T]
CTAATTCAAAAGAGACACCTTTTTGCATTTTGTTGAAGATCTCTTTGCTCTTTATTTATATANTTTTTGAGTTGAATAATCTTTNTGCCCGAGTTATACC
  
Genomic location of solcap_snp_sl_100624  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18167 marker 18167
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)