SGN Marker T1179

SGN-M1817
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TPTAA10TV
Arabidopsis best BAC match: AL021811.1
Arabidopsis position: 4.1640000
Arabidopsis identities: 0.605
Best GenBank protein hit: CAB79937.1
Evalue: 5.4e-32
Identities: 0.503
Description: putative protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49400)
Chromosome
8
Position
10.72 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47335)
Chromosome
8
Position
26.37 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39535)
Chromosome
8
Position
20.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1179 was used as an overgo probe on plate 12 [well H1]

Plausible BAC Matches:   P144L10,   P335P05,   P323O07,   P029N03,   P308A11,   P261J09,   P282E23,   P058G17,   P049M07,   P104P18,   P175H12,   P126D04,   P023I09,   P046H05,   P223I24,   P175J15,   P121J06,   P318A17,   P142L01,   P317M04,   P123K15,   P295B20,   P052K20,   P208H09,   P006H20,   P200H14,   P086F10

 Overgo Sequences

A sequence
GCTAGAGACATTCGCTGCAGTTTC
B sequence
GTTGGTTGACATCCCAGAAACTGC
AB sequence
GCTAGAGACATTCGCTGCAGTTTCTGGGAT
Marker sequence
CACATACAAGGAGAAATGGAGCAATTATAAACTTGCATCGGGGAAGAGTT
AAAACAGCAAACAAATATCCTATGCTCATTCGCAACTGTACGAAAGCATA
TGGTTACAAAGATGTGTAGAGAACTATCATTAATATCATGAAAATCTACT
GGGGGCATAAAATACCAGCTTCCTTCACCAGCTTCTCACTCAAAGCTGAA
AGTTGTGCCATCTCTGTATAAACTTCAGCAAGACATTCAAAACTGCTAGA
GACATTCGCTGCAGTTTCTGGGATGTCAACCAACCAAAGGCTGCTGTCAT
AGTCAGCCTCAATGGTCAAACTAGCTCTATTCAAAAGGCCACGGCTGAAT
TCAGCGAGTTTCCGGAGAGCACTGGTTGCAGCTTCAACTTCCAATTGAGC
TCCTTCAAATTGGAGCTTTTCAACTGCCAGATCTCCAGTGCTCTTTTCAC
CTGTTCTTTCCTGTGCCAAAGCATAAAGTTGCCTTACGCCATCTGCATCT
CGGGTCATTTCCTTCATTTTATTTATTTCTTCCTCCCTATCATTTAATTT
TTGACAAACTATTTTGAGCTCCTGCTCTTTGAGTTTAAGAGCCCTTTGTG
CTGCAAGAGAATCCATTTCT
Genomic location of T1179  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1817 marker 1817
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)