SGN Marker T1202

SGN-M1830
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TPTAA73TV
Arabidopsis best BAC match: AB010072.1
Arabidopsis position: 5.1220000
Arabidopsis identities: 0.690
Best GenBank protein hit: BAB09714.1
Evalue: 3.5e-48
Identities: 0.644
Description: strong similarity to unknown protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39543)
Chromosome
2
Position
142.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1202 was used as an overgo probe on plate 10 [well F8]

Plausible BAC Matches:   P100I18,   P257H21,   P248D13

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
GGTGGGAACTTCAGAATCAAAGCC
B sequence
TTACCAGGCTAGCCATGGCTTTGA
AB sequence
GGTGGGAACTTCAGAATCAAAGCCATGGCT
Marker sequence
GGTGGGAACCACATCCCATATATATATGTCACTTAGTTAATAACATTATA
CTATAGGTTTGGCCTACGCCTGTACCTTTTGACTAATACTGCGCTCTATA
CATTGATCAACTCGATCGCTGCAACAGTATTAAAGATTTTCTTTTGTTCT
TCTTTTACATAATACTATAGATCAAAGGTGGGAACTTCAGAATCAAAGCC
ATGGCTAGCCTGGTAAGGCAGGCGGGCCATTATATTCCTATACGAATCAC
TCTCTCTTTTCTCCTTCAGGTAATCAATACATCTCTCAACCTCAGACTTG
ACTTTCAAGTATAATTCATGTGCTTTCTCCTTGCTTTTAAGATCCTCCTT
CCTCCCTGCTGTTTCAATTGGCTTGCCAAAGTAGAAGTAAAAACGGCCAG
GAACTTTCGGAAGAATGATTGGAAGATGCACATCTTGGTTTGAAACCTCT
CCTTCAGTGTCATATCTTAACTTCTGCACCTCACCAGTTAACTCCTCTAT
GAGAGCCTTGAGATATGGAACCTTCATCATGTCATCATAATCAAGGAGCA
TCTGGCCAATATCATCTTCACCC
Genomic location of T1202  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1830 marker 1830
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)