SGN Marker solcap_snp_sl_100878

SGN-M18419

Synonyms  
SGN-U579212_snp24949
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 66979)
Chromosome
3
Position
80.69 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63455)
Chromosome
3
Position
84.92 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54750)
Chromosome
3
Position
60.12 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AGTACAATCCTTTGGCATAAAATTTTACCATCTTTTTTCTGCTTCGCAGC
  
3' flanking region
AAAGTTACTGAAACTCCAGTAGGTTCAGATTCAAGTGCAGCAAAAACTGA
SNP nucleotide
AT
SNPdb format
AGTACAATCCTTTGGCATAAAATTTTACCATCTTTTTTCTGCTTCGCAGC[A/T]
AAAGTTACTGAAACTCCAGTAGGTTCAGATTCAAGTGCAGCAAAAACTGA
  
Genomic location of solcap_snp_sl_100878  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18419 marker 18419
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)