SGN Marker solcap_snp_sl_100949

SGN-M18489

Synonyms  
SGN-U603133_snp167
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70497)
Chromosome
10
Position
19.85 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67022)
Chromosome
10
Position
27.62 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54820)
Chromosome
10
Position
3.09 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CAAAAAATGCTCACTATTCTAAGAAAGAATCAATCAATCCAAAACTAGAA
  
3' flanking region
GCGTGAGATTCATCCTATACCGATCATCACACCAAACATAAATTCCTAAT
SNP nucleotide
TC
SNPdb format
CAAAAAATGCTCACTATTCTAAGAAAGAATCAATCAATCCAAAACTAGAA[T/C]
GCGTGAGATTCATCCTATACCGATCATCACACCAAACATAAATTCCTAAT
  
Genomic location of solcap_snp_sl_100949  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18489 marker 18489
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)