SGN Marker CT233

SGN-M185

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
600
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
Forward sequence
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTACAAAATAAATTTGTCTTGTATTTCATCAATCAAATTATCAACTTCTCAAATATATT
CAATTAATTTGAAACCAAACTTTTTATGACAAAACTGTTGTATTAATGCAACAGGACTGTACAGTTAGCCTATCATTTCCACAAAACCAG
AATATGCAGAAAAAGGGTAAACAAAATAGAAAAATTCATGAATTAGTGGTCTCCGATGTAACTATGACTTCCACAGAGCGAGCCAAAGGC
TTACGACGAAAAAGCTGATCCAGTCTCGAGTGGCTCGCTGATTTCAAGAAGTTCATTGCAAAGACCTGTAAAAACGACGGAATCTGTTTC
TATAGGTTTAAATTTGAGTAGAGCTGAAGGAATCAAATCCTCCTCTTCAAGTGTT
Reverse sequence
AGTTTCCAGATGGAGTATTGCTTCAAGGTGTCTTTCTACCTTCTGAGCCAACTAGTGCTCTTTATGAGTTTGTGAGCTCGGCGTTAAAGG
AACCAAGCTTAGAGTTTGATTTGTTACATCCGGTGCTTGTCAAGAGGCGGGTGATACCCCATTTTCCAGCTACCGGGGAGAGGGCTATAA
CACTTGAAGAGGAGGATTTGATTCCTTCAGCTCTACTCAAATTTAAACCTATAGAAACAGATTCCGTCGTTTTTACAGGTCTTTGCAATG
AACTTCTTGAAATCAGCGAGCCACTCGAGACTGGATCAGCTTCTTCGTCGTAAGCCTCTGGCTCGCTCTGTGGACGTCATAGTTACATCG
GAGACCACTAATTCATGAATTTTTCTATTTTGTT
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U164477373 (89.9% of RFLP seq)+
SGN-U164477328 (83.2% of RFLP seq)-
Mapped locations  
Map: Tomato QTL map   
Map version
137 (location: 53763)
Chromosome
1
Position
2.80 cM
Confidence
uncalculated
Protocol
RFLP

Hexanal_content_hxa1_1 Pentanal_content_pna1_1 Titratable_acidity_ta1_1 Elasticity_ela1_1
Tomato QTL map

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49335)
Chromosome
1
Position
0.30 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47272)
Chromosome
1
Position
1.71 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Sun1642 x LA1589   
Map version
85 (location: 43648)
Chromosome
1
Position
17.00 cM
Confidence
uncalculated
Protocol
RFLP


Sun1642 x LA1589

Map: Tomato-LXCHM 2007   
Map version
68 (location: 42960)
Chromosome
1
Position
0.00 cM
Confidence
uncalculated
Protocol
CAPS


Tomato-LXCHM 2007

PCR data   Exp. ID 43960
Forward primer (5'-3')
CCCTATCATTTCCACAAAACCAGA
Accessions and product sizes
Approximate temperature
58°C
Reverse primer (5'-3')
GGTGTCTTTCTACCTTCTGAGCCA
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40751)
Chromosome
1
Position
0.00 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2008

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39028)
Chromosome
1
Position
0.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8481)
Chromosome
1
Position
0.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 8485)
Chromosome
1
Position
0.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPIMP 2001
Overgo hybridization and physical mapping 
CT233 was used as an overgo probe on plate 1 [well E9]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
ATGACTTCCACAGAGCGAGCCAAA
B sequence
TTTTTCGTCGTAAGCCTTTGGCTC
AB sequence
ATGACTTCCACAGAGCGAGCCAAAGGCTTA
Marker sequence
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTACAAAATAAATTTGTCT
TGTATTTCATCAATCAAATTATCAACTTCTCAAATATATTCAATTAATTT
GAAACCAAACTTTTTATGACAAAACTGTTGTATTAATGCAACAGGACTGT
ACAGTTAGCCTATCATTTCCACAAAACCAGAATATGCAGAAAAAGGGTAA
ACAAAATAGAAAAATTCATGAATTAGTGGTCTCCGATGTAACTATGACTT
CCACAGAGCGAGCCAAAGGCTTACGACGAAAAAGCTGATCCAGTCTCGAG
TGGCTCGCTGATTTCAAGAAGTTCATTGCAAAGACCTGTAAAAACGACGG
AATCTGTTTCTATAGGTTTAAATTTGAGTAGAGCTGAAGGAATCAAATCC
TCCTCTTCAAGTGTT
Genomic location of CT233  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D185 marker 185
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)