SGN Marker T1283

SGN-M1894
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 30.13
Tomato EST read: TPTAF91TH
Arabidopsis best BAC match: AB012247.1
Arabidopsis position: 3.0350000
Arabidopsis identities: 0.372
Best GenBank protein hit: CAA69181.1
Evalue: 4e-102
Identities: 0.966
Description: MFP1 protein [Lycopersicon esculentum]
Comment: a novel plant filament-like protein with affinity for matrix attachment region DNA
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39568)
Chromosome
3
Position
149.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1283 was used as an overgo probe on plate 2 [well B9]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
AAGAGGTGAGTCTTCGGAGTAGCA
B sequence
TCAGCTAGTTTAGAGGTGCTACTC
AB sequence
TGTTGGGGGAACAAGAGAAGAGACTACACC
Marker sequence
GATTGCAGGAAGAGCTTAAAGAGAAGCTTGATTTGATACAAGTTCTTGAA
GAAAAGATTACTTTGCTTACTACAGAGATCAAAGATAAAGAGGTGAGTCT
TCGGAGTAGCACCTCTAAACTAGCTGAAAAAGAATCGGAGGTAAATAGTT
TGAGCTCTATGTATCAACAATCCCAGGATCAGCTGATGAATTTGACTTCA
GAGATCAAAGAACTTAAAGATGAAATCCAGAAAAGAGAGAGAGAACTGGA
GTTGAAATGTGTATCAGAAGACAACCTGAATGTGCAATTAAATTCTTTGC
TCCTCGAGAGAGATGAATCTAAAAAAGAGCTTCATGTTATTCAAAAGGAA
TACAGTGAGTTCAAGTCCAATTCTGATGAGAAGGTGGCTTCAGATGCGAA
GCTGTTGGGGGAACAAGAGAAGAGACTACACCAGCTTGAGGAACAACTTG
GCACTGCCTTAAGTGAAGCAAGTAAAAATGAAGTGCTAATTGCTGATCTG
ACTCGAGAAAAAGAAAACCTTANGAGAATGGTGGATGCTGAGCTGGACAA
TGTAAACAGGTTGAAGCAAGAGATTGAAGTCACTCAGGAAAGTCTTGAGA
ATTCAAGAAGTGAAGTTTCTGAT
Genomic location of T1283  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1894 marker 1894
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)