SGN Marker T1315

SGN-M1919
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 11.05.03
Tomato EST read: TPTAN01TH
Arabidopsis best BAC match: AC007233.6
Arabidopsis position: 2.0300000
Arabidopsis identities: 0.715
Best GenBank protein hit: AAD26909.1
Evalue: 4.8e-73
Identities: 0.680
Description: "putative beta-1,3-glucanase [Arabidopsis thaliana]"
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39574)
Chromosome
7
Position
41.50 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1315 was used as an overgo probe on plate 10 [well B2]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
ACCGAAAGAAGACCTCACCGTCTT
B sequence
GAAAAGAGCGAAGAGGAAGACGGT
AB sequence
ACCGAAAGAAGACCTCACCGTCTTCCTCTT
Marker sequence
GACGACACCGAAATCGGCGCTTCCGTCGACAACGCCGCGTCGTACAACGG
AAACCTCGTCCGGCGGATACTTATCGGTGGAGGAACCCCTTTGAGACCGA
AAGAAGACCTCACCGTCTTCCTCTTCGCTCTTTTCAACGAGAACAAAAAA
CCGGGTCCAACTTCCGAGAGAAACTTCGGGTTGTTCTACCCAAATGAGCG
AAAAGTTTACAACATACCATTAACAATGGAAGGTTTAAAGCATTACGTTG
ACCGGCGGTCACCGGCGGCCGGCGAGCAGAGAACGCAGAAAGGCGGGAAG
GTGAATGTGTCAGGGCAAACATGGTGCGTAGCGAGTGGAGAAGCGGAGAA
GGATCACCTACAAGCAGCTCTAGATTATGCTTGTGGTGAGGGTGGAGCAG
ATTGCCGTTCGATTCAACCAGGTTCCACGTGTTACAATCCTAACACGTTA
GAGGCTCATGCATCATTCGCTTTTAATAGTTATTATCAGAAAAAAGGCCG
TGCGATGGGTTCGTGTTATTTTGGTGGGGCCGCATTCATTGTTCATCAAC
AACCTAAGTATGGACACTGTGAATTACCAACTGAAGAATGAGTAGAGGGG
TGGGGATAGACTGAATTTTGAT
Genomic location of T1315  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1919 marker 1919
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)