SGN Marker solcap_snp_sl_16925

SGN-M19554

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 71127)
Chromosome
1
Position
40.84 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67473)
Chromosome
1
Position
31.22 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 55885)
Chromosome
1
Position
18.52 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GATGCCATGTGGGAAGATGTCAAATCGCCAAAAGAACCAGTCTTGGCAAA
  
3' flanking region
GATCAGAGCAATCTTGAAGTTTATCATTATCCCATCCGCGGGATCGCTCT
SNP nucleotide
TG
SNPdb format
GATGCCATGTGGGAAGATGTCAAATCGCCAAAAGAACCAGTCTTGGCAAA[T/G]
GATCAGAGCAATCTTGAAGTTTATCATTATCCCATCCGCGGGATCGCTCT
  
Genomic location of solcap_snp_sl_16925  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D19554 marker 19554
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)