SGN Marker solcap_snp_sl_1827

SGN-M19701

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 56032)
Chromosome
1
Position
74.60 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CACTACAAGCCTAGATAACAAAAGTATATCCTTCAGTAAGCATACATGGT
  
3' flanking region
TCAGCCAACTTCAAACCCCGAGACTTGAAGAATCAATCCTTCCCGAGGCT
SNP nucleotide
AT
SNPdb format
CACTACAAGCCTAGATAACAAAAGTATATCCTTCAGTAAGCATACATGGT[A/T]
TCAGCCAACTTCAAACCCCGAGACTTGAAGAATCAATCCTTCCCGAGGCT
  
Genomic location of solcap_snp_sl_1827  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D19701 marker 19701
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)