SGN Marker solcap_snp_sl_20801

SGN-M19948

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 71263)
Chromosome
3
Position
89.47 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67619)
Chromosome
3
Position
85.75 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 64009)
Chromosome
3
Position
93.87 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 56279)
Chromosome
3
Position
60.86 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CAGCAGTTGCTGATTCACAATGGTAAAGTGCTGAAAGATGAAAGTACATT
  
3' flanking region
TTGGAAAACAATGTCTCTGAGGATGGTTTTCTTGTTGTCATGCTTAGCAA
SNP nucleotide
AG
SNPdb format
CAGCAGTTGCTGATTCACAATGGTAAAGTGCTGAAAGATGAAAGTACATT[A/G]
TTGGAAAACAATGTCTCTGAGGATGGTTTTCTTGTTGTCATGCTTAGCAA
  
Genomic location of solcap_snp_sl_20801  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D19948 marker 19948
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)