SGN Marker solcap_snp_sl_21352

SGN-M20103

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 71318)
Chromosome
4
Position
15.41 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67679)
Chromosome
4
Position
27.38 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 64068)
Chromosome
4
Position
23.19 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 56434)
Chromosome
4
Position
2.30 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TCTGTTTCTAAGATTCTCAGAGAAGTTCCTGGAAATGACAAGTGTGCTGA
  
3' flanking region
TGTGGTGCTTCAGAACCTGATTGGGCTTCTCTAAATCTTGGAATCCTAAT
SNP nucleotide
AC
SNPdb format
TCTGTTTCTAAGATTCTCAGAGAAGTTCCTGGAAATGACAAGTGTGCTGA[A/C]
TGTGGTGCTTCAGAACCTGATTGGGCTTCTCTAAATCTTGGAATCCTAAT
  
Genomic location of solcap_snp_sl_21352  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D20103 marker 20103
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)