SGN Marker T1456

SGN-M2015
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TPTAU26TH
Arabidopsis best BAC match: AB005230.2
Arabidopsis position: 5.0210000
Arabidopsis identities: 0.606
Best GenBank protein hit: BAB11112.1
Evalue: 4.3e-35
Identities: 0.575
Description: cell cycle switch protein [Arabidopsis thaliana]
Comment: no experimental evidence
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49440)
Chromosome
6
Position
26.11 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47374)
Chromosome
6
Position
11.07 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39628)
Chromosome
6
Position
10.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1456 was used as an overgo probe on plate 3 [well H7]

Plausible BAC Matches:   P259K12,   P303K10,   P149K17,   P281O11,   P199D09,   P230K14,   P020D21,   P005B19,   P196B03,   P316L14,   P027B21,   P014H24,   P186J23,   P244F11,   P165K18,   P333J07,   P007K09

 Overgo Sequences

A sequence
GGAAACCTCTCTTCGTCTTGATGC
B sequence
GGGAGGAGAAGAAAAAGCATCAAG
AB sequence
GGAAACCTCTCTTCGTCTTGATGCTTTTTC
Marker sequence
GTCTATACAGAATTGAGCTTCTGCCATTGATTTGAGCTCAACAAAATTAA
AAAAAAAAACATGGAGCCGATAACTCAAAGAAGAAAGAGTGGAATTAACC
TTCCATCTACAATGTCGGAAACCTCTCTTCGTCTTGATGCTTTTTCTTCT
CCTCCCAGATCAAAGCGAACAACCAATTTGGCTTCATCGCCAATGTCAAA
CAGGTCACCTCGGACAATATCGAATCTGTCATCATCTCCGTCTTCTAAAT
CTGCAAGTTGCAGTGATAGATTCATTCCTTGTAGATCTTCTTCAAGGCTG
CATACTTTTGGTCTGGTGGAGAAGGCGTCTCCGGTGAAAGAAGGAGGAGG
AGGAAACAATGATGCATATTCCAGGTTGTTGAAATCTGAGCTTTTTGGAG
CTGATTTTAGTTGTTTCTCTTCTCCTGCAGGTTCTAAGGGATGTGCTAAT
TCACCCATGAGTCCCAGTAAGAATATGCTCAGATTTAAAACTGAAAATTC
TGGCCCTAATTCCCCTTCCGTTTT
Genomic location of T1456  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2015 marker 2015
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)