SGN Marker solcap_snp_sl_2219

SGN-M20210

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67721)
Chromosome
1
Position
69.76 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 56541)
Chromosome
1
Position
78.33 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TGAATCATTCTGGCTTGGACTGCTTTATATTCGGATCTGATTTCTGACAT
  
3' flanking region
TGATTTCTTTTTATTTGAAAGAAGTAGATGAATGCGAAGGTACCCAGCGG
SNP nucleotide
AC
SNPdb format
TGAATCATTCTGGCTTGGACTGCTTTATATTCGGATCTGATTTCTGACAT[A/C]
TGATTTCTTTTTATTTGAAAGAAGTAGATGAATGCGAAGGTACCCAGCGG
  
Genomic location of solcap_snp_sl_2219  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D20210 marker 20210
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)