SGN Marker solcap_snp_sl_23590

SGN-M20515

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2000   
Map version
145 (location: 64222)
Chromosome
4
Position
158.86 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 56846)
Chromosome
4
Position
63.50 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TGGTATAAAGGTGGTGCTCTTAACAAAAAGCAAAATTGCTTTGATGACTT
  
3' flanking region
ATTTCTGCTGCTGAGTATCTTGTATGTGCTGGTTATACACAGCCACATAA
SNP nucleotide
TC
SNPdb format
TGGTATAAAGGTGGTGCTCTTAACAAAAAGCAAAATTGCTTTGATGACTT[T/C]
ATTTCTGCTGCTGAGTATCTTGTATGTGCTGGTTATACACAGCCACATAA
  
Genomic location of solcap_snp_sl_23590  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D20515 marker 20515
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)