SGN Marker solcap_snp_sl_23596

SGN-M20520

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 71440)
Chromosome
4
Position
92.18 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 64225)
Chromosome
4
Position
158.86 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 56851)
Chromosome
4
Position
63.56 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CTTCTTTACAGCAAGTCAAAATTCCTTCCGCCGGCGGCCGTGATCCCGTC
  
3' flanking region
CCGGAAGGAACGCTGTTCTGTAGATACACAAATTTCAGACGGAATTGCAT
SNP nucleotide
TG
SNPdb format
CTTCTTTACAGCAAGTCAAAATTCCTTCCGCCGGCGGCCGTGATCCCGTC[T/G]
CCGGAAGGAACGCTGTTCTGTAGATACACAAATTTCAGACGGAATTGCAT
  
Genomic location of solcap_snp_sl_23596  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D20520 marker 20520
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)