Notice: Due to a server issue, SGN was unavailable earlier today. We apologize for any inconvenience.

SGN Marker solcap_snp_sl_23604

SGN-M20524

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 71442)
Chromosome
4
Position
92.99 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67835)
Chromosome
4
Position
107.80 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 64227)
Chromosome
4
Position
158.86 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 56855)
Chromosome
4
Position
63.89 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TGCGGGGAACATAATCTGGGATCAACAGGTCCTGGCAAATTGAACGATAT
  
3' flanking region
GTAAAAGGCCCAGGGGAAGGAAGCTGCTGAACTTTCATCTCATAACCCTT
SNP nucleotide
AG
SNPdb format
TGCGGGGAACATAATCTGGGATCAACAGGTCCTGGCAAATTGAACGATAT[A/G]
GTAAAAGGCCCAGGGGAAGGAAGCTGCTGAACTTTCATCTCATAACCCTT
  
Genomic location of solcap_snp_sl_23604  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D20524 marker 20524
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)