SGN Marker solcap_snp_sl_24454

SGN-M20706

Synonyms  
SGN-U580182_snp1019
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 71544)
Chromosome
6
Position
51.13 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67909)
Chromosome
6
Position
56.46 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 64301)
Chromosome
6
Position
64.34 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 57037)
Chromosome
6
Position
41.07 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GTGCATTTTTTCCATGATGGACAAGGTTTCATGTCTGTTGAGTTGACACC
  
3' flanking region
ACAGAGGCTGAGATCAAATATTATGATGTTTTTGGTAGAATTAGACATAG
SNP nucleotide
AG
SNPdb format
GTGCATTTTTTCCATGATGGACAAGGTTTCATGTCTGTTGAGTTGACACC[A/G]
ACAGAGGCTGAGATCAAATATTATGATGTTTTTGGTAGAATTAGACATAG
  
Genomic location of solcap_snp_sl_24454  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D20706 marker 20706
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)