SGN Marker T1546

SGN-M2085
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 30.04
Tomato EST read: TPTBB35TH
Arabidopsis best BAC match: AB016886.1
Arabidopsis position: 5.1710000
Arabidopsis identities: 0.933
Best GenBank protein hit: BAB11329.1
Evalue: 9.7e-78
Identities: 0.877
Description: kinesin-like protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39673)
Chromosome
4
Position
98.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1546 was used as an overgo probe on plate 7 [well F2]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GCTAGAAGCGCGTAAATCTTCAGG
B sequence
AACTGAGTTCTCGCGACCTGAAGA
AB sequence
GCTAGAAGCGCGTAAATCTTCAGGTCGCGA
Marker sequence
GGGAAGAAGGAATGAGTATGAGAGACATAAATTGCTAGCTTTAAATCAAC
GACAAAAGATGGTTCTTCAAAGAAAGACGGAGGAGGCTGCTATGGCAACT
AAGAGACTAAAAGAATTGCTAGAAGCGCGTAAATCTTCAGGTCGCGAGAA
CTCAGTTACTAGCAATGGCCATGTAGCAAATGGACAGAGCAATGAGAAAT
CGTTGCAACGTTGGCTTGATCATGAGCTTGAAGTGATGGTGAATGTTCAT
GAAGTTCGTCATGAGTATGAGAAGCAAAGTCAAGTACGAGCCGCACTTGG
TGAAGAGCTAGCAGTTTTGAAACAAGTTGATGAATTTGCTTCAAAAAGAC
TGAGTCCTCCAAGGGGTAAAAATGGTTTCTCTAGGGCATCTTCAATGTCG
CCAAATGCTAGAATGGCACGAATTGCTTCTCTAGAGAATATGTTAGGCAT
TTCATCCAATTCCCTAGTTGCAATGGCTTCACAACTTTCAGAAGCAGAAG
AACGAGAGCGTGCCTTT
Genomic location of T1546  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2085 marker 2085
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)