SGN Marker T1586

SGN-M2114
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 1.06.1.05
Tomato EST read: TPTBF09TH
Arabidopsis best BAC match: AC005970.2
Arabidopsis position: 2.0320000
Arabidopsis identities: 1.000
Best GenBank protein hit: CAA74176.1
Evalue: 1.9e-82
Identities: 0.892
Description: enoyl-ACP reductase [Nicotiana tabacum]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39695)
Chromosome
1
Position
15.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1586 was used as an overgo probe on plate 3 [well C4]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TGGCGGTGAAACTCAAAAACTGTC
B sequence
GGCAAGTCTGTTACAGGACAGTTT
AB sequence
TGGCGGTGAAACTCAAAAACTGTCCTGTAA
Marker sequence
GGTCACTTCAAGAAATGGCAGCATCTGCAGCTTCAAGCTTTCAAATAACA
ATAGCTAGGCCATCCATACTCTCTACTAAAAGAATTTCCAGTTTCTGCTC
GACAAAGTTTGGCGGTGAAACTCAAAAACTGTCCTGTAACAGACTTGCCA
GTAGTTGTCATGTTTCATCCATCCAACATTTTTGGCGCAGTTTCACATCT
ACGACTCAAAAGTTTCAGAAAGTTGTTACCAAGGCAAAATCAGAAGCTGA
TGATAGCAAGCCCGCCTCTGTTTTGCCGATTGATTTGAGAGGTAAAAGGG
CTTTTATAGCTGGTATAGCTGATGATAATGGATATGGGTGGGCTATTGCT
AAGTCCCTGGCTGCTGCAGGTGCCGAAATTCTAGTTGGAACCTGGGTGCC
AGCCTTAAACATTTTTGAAACAAGTCTTCGACGTGGAAAGTTTGATGAAT
CACGCGTTTTGCCAGATGGTTCTTTGATGGAGATTACTAAAGTATACCCC
CTCGATGCTGTTTTTGATAGTCTTGAGGATGTACCTGAAGATAT
Genomic location of T1586  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2114 marker 2114
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)