SGN Marker T1621

SGN-M2141
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 6.01
Tomato EST read: TRZAA44TH
Arabidopsis best BAC match: AL021635.1
Arabidopsis position: 4.1170000
Arabidopsis identities: 0.684
Best GenBank protein hit: CAB79222.1
Evalue: 8.1e-56
Identities: 0.608
Description: HSP associated protein like [Arabidopsis thaliana]
Comment: 9.00e-51 match with gb|AAB38382.1| (U28918) p48 [Homo sapiens]
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39709)
Chromosome
3
Position
139.00 cM
Confidence
F(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 13985
Forward primer (5'-3')
GACTGGTGAGGACGATGATG
Digested band sizes (using HinfI)
Solanum lycopersicum LA925: 550
Solanum pennellii LA716: 600
Mg+2 concentration
Unknown
Reverse primer (5'-3')
CGGCAATCTCTTCGTCAAA
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1300
Solanum lycopersicum LA925: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 13985
Forward primer (5'-3')
GACTGGTGAGGACGATGATG
Digested band sizes (using HinfI)
Solanum pennellii LA716: 600
Solanum lycopersicum LA925: 550
Mg+2 concentration
Unknown
Reverse primer (5'-3')
CGGCAATCTCTTCGTCAAA
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1300
Solanum lycopersicum LA925: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 14094
Forward primer (5'-3')
GACTGGTGAGGACGATGATG
Digested band sizes (using HinfI)
Solanum lycopersicum LA925: 550
Solanum pimpinellifolium LA1589: 600
Mg+2 concentration
Unknown
Reverse primer (5'-3')
CGGCAATCTCTTCGTCAAA
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 600
Solanum lycopersicum LA925: 600
Approximate temperature
55°C
  
PCR data   Exp. ID 49
Forward primer (5'-3')
Unknown
Digested band sizes (using HinfI)
Solanum pennellii LA716: 600
Solanum lycopersicum LA925: 550
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
Unknown
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1300
Solanum pennellii LA716: 1300
Approximate temperature
55°C
  
Overgo hybridization and physical mapping 
T1621 was used as an overgo probe on plate 2 [well A5]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
TTCTCGAAAGCTTGGGTGCTCAAC
B sequence
TTAACCGACGGAGGAAGTTGAGCA
AB sequence
TTCTCGAAAGCTTGGGTGCTCAACTTCCTC
Marker sequence
GACTAAAACTAAGACACAGAGAGAAAGAGAGTAGACTGGTGAGGACGATG
ATGGATACTGAGAAGCTTGAAGACCTAAAGCATTTTGTGGAGCTTTGCAA
AGAGAATCCTTCAATTTTACAGAATCCTTCGCTAACCTTTTTCAAGACCT
TTCTCGAAAGCTTGGGTGCTCAACTTCCTCCGTCGGTTAAATCTGAACAA
TGTGGAGAGGAGCATCATGATGAACTGGATGAAGACATTGTAGAGTCTGA
TGTTGAGTTGGATAACACTGATATTGTGGAACCTGACAATGATCCTCCAC
AACAGATGGGAGATTCTACTACTGAAGTAACAGATGAAAATCGAGATGCT
GCTCAAATATCAAAAGCGAAAGCACTGGATGCAATATCTGAAGGCAAGCT
TGATGAAGCCATAAATCATTTAACTGAAGCTATTTTGTTGAATCCAACTT
TTGCAATATTATACGCAACAAGAGCTAATGTCTTCATTAAGCTGAAAAAG
CCCAATGCTGCAATCCGTGATGCTGATGCTGCTTTAAAGGTCAACCCTGA
CTCAGCAAAAGGATACAAAGTGAGGGGTATGGCTCGAGCAATGTTGGGCT
TATGGAAAGAGGCAGCTAGCGATCTTCGTGTGGCATCCATGATAGATTNT
GACGAAGAGATTGCCGAGATACTT
Genomic location of T1621  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2141 marker 2141
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)