SGN Marker T1622

SGN-M2142
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 9.01
Tomato EST read: TRZAA50TH
Arabidopsis best BAC match: AC004005.2
Arabidopsis position: 2.2380000
Arabidopsis identities: 0.604
Best GenBank protein hit: AAC23398.1
Evalue: 1.1e-76
Identities: 0.647
Description: putative polygalacturonase [Arabidopsis thaliana]
Comment: cell wall degradation in prunus
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39710)
Chromosome
12
Position
55.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1622 was used as an overgo probe on plate 5 [well E4]

Plausible BAC Matches:   P269M15,   P256P20,   P024I03

 Overgo Sequences

A sequence
GTACCTCAGTTGAACCATCGACGA
B sequence
CCCTTCGGAACGTAAATCGTCGAT
AB sequence
GTACCTCAGTTGAACCATCGACGATTTACG
Marker sequence
TCAATCCATCTTTACTCAAACATTATGACTAGTAAGCTTATAACACCTTT
CATTATTTTCCTCTTTTCTTCTATACTTAATTTATTCATAAAATCATCAA
ATGCATCAACAACCTACAATGTATTAAGCTTTGGTGCAAAACCAAATGGC
CAAATTGATGCAACTCAATCATTTCTAAATGCATGGAGAGCTGCTTGTAC
CTCAGTTGAACCATCGACGATTTACGTTCCGAAGGGACGTTATTTAATAA
AAGAAGCAACATTTAGAGGTCCATGTAAAAGTAAAATTACAGTAAAGATT
GATGGAACTCTTGTTGCACCATTGGATTATTGGGGAATTGGTAATTCTGG
TTATTGGATTTTGTTTATTGAGGTTAATGGGATTTCAGTTATAGGTGGGA
GTATTGATGCTAAAGGAGATGGTTTTTGGGCTTGTAGAAAGTCAGGAAAT
AATAATTGTCCAGTTGGAGCTAGGTCTATAACCTTCAATTGGGCTAATGA
TGTTGTGGTAAGTGGTTTACTATCAATCAACAGCCAGGTAACACACCTTG
TGATCAATAGTTGCAACAATGTAATGGTTAAAAATGTAAAAGTAATAGCC
CCAGATCAAAGCCCAAACACAGATGGAATTCATGTTCAATCATCAACAAA
TGTTACTATCATTGGTTGTAGAATCAAAACT
Genomic location of T1622  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2142 marker 2142
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)