SGN Marker T1632

SGN-M2149
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TRZAA96TH
Arabidopsis best BAC match: AC005292.4
Arabidopsis position: 1.0510000
Arabidopsis identities: 0.582
Best GenBank protein hit: AAF87006.1
Evalue: 6.9e-57
Identities: 0.497
Description: unknown protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39716)
Chromosome
5
Position
4.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1632 was used as an overgo probe on plate 11 [well A11]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TCTGAATCAATGCCCGCCATACTC
B sequence
ATGCCGCTGAGTCTTTGAGTATGG
AB sequence
TCTGAATCAATGCCCGCCATACTCAAAGAC
Marker sequence
GGGATGAAGCTCCTATTCATGGAGATGTATTGGAAACGATTCTTTCACAC
GTGCCACTTGTCGACTTAGTTCCTTCTTCGTGCGTTTCAAAATCATGGAA
TCGAGCTGTTGCTTCTTCTCTGAAATGCTTCAACAAGCCGAAGCCGTGGT
TAATTATCCACACTCAATGCACCCGCTCACCTTATGACATTTCGGTACGT
GGCTACGACCCTCGCTCGAATGTTTGGGTCGACATGTCTCGACCATCCAT
TAAGTATATCTCTGCACTCCGATCATCTCATTCCAATTTACTCTACATGC
TTTCTCCATCGAAGCTATCCTTCTCCCACGACGTCATGAATCTCACGTGG
CATCACGTCGATGCACCGCGCGTGTGGAGAACCGATCCTATTGTGGGTTA
TGTAGGTGGCTCCATCGTTATAGCCGGTGGCACGTGCGATTTTGAAGATG
ATCCATTAGCTGTGGAAATTTACAATAACGAAACCAACACTTGGGAAACG
TCTGAATCAATGCCCGCCATACTCAAAGACTCAGCGGCATCTACGTGGCT
GTCAATCGCTGCCACCGGCGATAAACTCGTCGTTGCAGAGAAATTCACCG
GAGTTACTTACTGTTTCCATCCGAAAACGAAGAATTGGTCAGGTCCGTAT
GA
Genomic location of T1632  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2149 marker 2149
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)