SGN Marker solcap_snp_sl_29325

SGN-M21507

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2000   
Map version
145 (location: 64594)
Chromosome
4
Position
159.53 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 57838)
Chromosome
4
Position
63.45 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TGACAGCAACTAAACAAGCCTCAACAACAGTTTTAACAACTTCAGGACCA
  
3' flanking region
CACCAGCAGAATTAATATTATCGGTGTTCTCACCATTGTTGACAGCACCT
SNP nucleotide
TG
SNPdb format
TGACAGCAACTAAACAAGCCTCAACAACAGTTTTAACAACTTCAGGACCA[T/G]
CACCAGCAGAATTAATATTATCGGTGTTCTCACCATTGTTGACAGCACCT
  
Genomic location of solcap_snp_sl_29325  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D21507 marker 21507
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)