SGN Marker T1669

SGN-M2178
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TRZBD08TH
Arabidopsis best BAC match: AC007454.3
Arabidopsis position: 1.0740000
Arabidopsis identities: 0.714
Best GenBank protein hit: BAA97016.1
Evalue: 1.0e-78
Identities: 0.640
Description: contains similarity to alpha/beta hydrolase
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49480)
Chromosome
1
Position
83.98 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47414)
Chromosome
1
Position
120.53 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39735)
Chromosome
1
Position
130.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1669 was used as an overgo probe on plate 8 [well E4]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
ATGGACGGAAGATTCCCGAAGAGT
B sequence
GTGGAGATGGTCAATGACTCTTCG
AB sequence
ATGGACGGAAGATTCCCGAAGAGTCATTGA
Marker sequence
GGGCGGGATAATAGCTTTGGATTGGCTAAGAAACATCGATGTTGAAAAGC
CATCCATTGAGCATTTTGATGGAGTTCAGAGTGATGATAAAAGTCCCATC
ATGCTAGTGATTCCTGGTTTAACAAGTGACTCTGATTCTGCTTACATTAA
GCATCTTACTTTCAAGATGGCCAAACGTGGATGGAATGTTGTTGTGAGCA
ATCATCGGGGTCTCGGTGGAGTGTCAGTAACTTCTGATTGCTTTTATAAT
GCTGGATGGACGGAAGATTCCCGAAGAGTCATTGACCATCTCCACACCCA
ATACCCTCAGGCTCCTATATTTGCTGTTGGCCTTAGCATTGGTGCTAATG
TTCTGGTAAAATATCTCGGTGAGGAAGGAGTTAATACTGTAATTGTTGGG
GCAGCTGCTATTTGTTCTCCTTGGGACCTTTTGATTTGTGACAGGTATAT
TAATCGCAGGCTTGTGCAGAGAGTCTATGACAGAGCTCTGGCAATTGGAT
TAAAAGGTTATGCCAAGATGCATCAGACAGTAATGTCTCGGTTGGCAGAT
TGGGAAGGCATTGTTAAGGCACGTTCTGTCAGAGATTTTGACCACAGTTC
TACTCGTGTTCTTGCTGATCTTGA
Genomic location of T1669  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2178 marker 2178
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)