SGN Marker solcap_snp_sl_3103

SGN-M21851

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 72134)
Chromosome
4
Position
50.31 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 58182)
Chromosome
4
Position
55.10 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ACCTTGGTTCCACAACTTCTTTGGCTGATGTTGATTCGGTCAAACAAGTT
  
3' flanking region
GTGGATCTACTCCGGATAAAATACCCGCATCAGCAAGTGGCAGTCCTGTA
SNP nucleotide
AG
SNPdb format
ACCTTGGTTCCACAACTTCTTTGGCTGATGTTGATTCGGTCAAACAAGTT[A/G]
GTGGATCTACTCCGGATAAAATACCCGCATCAGCAAGTGGCAGTCCTGTA
  
Genomic location of solcap_snp_sl_3103  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D21851 marker 21851
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)