SGN Marker T1756

SGN-M2248
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 1.05
Tomato EST read: TRZBK89TH
Arabidopsis best BAC match: AP000372.1
Arabidopsis position: 5.1750000
Arabidopsis identities: 0.907
Best GenBank protein hit: CAA38954.1
Evalue: 1.8e-69
Identities: 0.914
Description: glucose-1-phosphate adenylyltransferase [Solanum tuberosum]
Comment: functions in starch synthesis
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39772)
Chromosome
7
Position
45.70 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1756 was used as an overgo probe on plate 8 [well G4]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
AGGGCTTTGTGGAAGTTCTTGCTG
B sequence
TCCGGACTTTGTTCAGCAGCAAGA
AB sequence
AGGGCTTTGTGGAAGTTCTTGCTGCTGAAC
Marker sequence
ACTTGGATCAAATTATCGGCTGATTGACATTCCCGTAAGCAATTGCTTGA
ACAGTAACATATCCAACATCTATGTTTTTACACAATTCAACTCTGCCTCT
ATAAATCGCCACCTTTCACGGGCATATGCTAACAATATGGGAGGATACAA
AAACGAGGGCTTTGTGGAAGTTCTTGCTGCTGAACAAAGTCCGGAGAACC
ACGATTGGTTCCAAGGCACTGCGGACGCTGTCAGACAATATCTGTAGTTG
TTTGAGGAGCATAATGTGCATGAATACCTTATACTTGCTGGAGATCATCT
GTATCGAATGGATTATGAAAAGTGTATTCAAGCCCACAGGGAAACAGATG
CTGATATTACCGTTGCCGCACTGACAATGGACGAGAAGCGTGCCACTGCA
TTCGGTCTCATGAAGATTGATGAA
Genomic location of T1756  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2248 marker 2248
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)