Notice: The FTP site is available again. We apologize for any inconvenience.

SGN Marker TG130

SGN-M226

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1600
Vector
pUC
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
ATTCAGTTAAGCATTTTTACAAACACATAATCTGCAATTTTACATTCTCCGGTTGGATCGCCGGTTTCCGGTATGGAAACAATCGGCCGG
AACCCACTTTGTTTTTCATCTAAAATTCTTTACACACAATTATAGTTAGATAATTGATAAACAAACCCGATATATATAAATTTTATTTTT
TTTGGTTGAAATGGCTGACATCAATGTTAACTCAGTGTTGACTTCGGGGGAAGATATGGCGGAGAAAGCATTGAGCAAGAGATATGAAGG
GTTAGTTGCTGTCCGTACAAAAGCTATAAAAGGGAAAGGAGCTTGGTACTGGGCTCATCTGGAGCCTGTTTTGATTCAAAACCCGGAAAC
GAATCATCCAAAAGCAGTGAAACTTAAGTGCACTTTGTGTGATGCTGCGTTTTCGGCTTCAAATCCGTCACGGACTGCTACAGAGCATCT
AAAAAGAGGTACTTGTCCCAATTTTGGCGCTGTTTTGAGGCCCATTTCACAGTTACCCC
Reverse sequence
TTGGGCTGAGTATTCGAGCATAACTTAGTATATCCTCCAACATTGCAATAACAGGACCATAGTTCTTAGACAGATTGCAGTCAGCTGAAG
GAACTCTAATCAACCCTGCAAGCTCAACACCGTGCGACCTGAATTTCCTAAAATGATTTCTGATTTGGGACTTGCTATTGAAAAGATTTG
CAATTTTTAAGCAATTATCAGTAACGATTTTAAAAAGTGGAAGTTCTCTACCAAAGTCCTTCAACAAACTAATAAATCCATGAAGTTGGC
ATGAAAGATTCACCATCCAATGATTTTGTAACTCCAAATTCCTCAATGCCTTACTTTTATACTTGTCTCCAACTATTCCCACACATCTTT
GAACAACATTACCACACAACCCTTTAATAGTTTCCCGTAAAACTTCCTCTGCATACTCCGATGGCACCAATCCGCCCTTATACACTGCCT
TATGAAATACATTAGTACCGTTAGGAAGATTTATGATAAATTTAATCACAGTATCTTCCCCATACTTACAAATATCCCTCCCC
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U171322482 (94.7% of RFLP seq)+
SGN-U155739474 (88.9% of RFLP seq)-
Mapped locations  
Map: Tomato QTL map   
Map version
137 (location: 53868)
Chromosome
3
Position
16.20 cM
Confidence
uncalculated
Protocol
RFLP

Titratable_acidity_ta3_1 Fruit_diameter_fd3_1 Elasticity_ela3_1 Fruit_weight_fw3_1 2_Phenylethanal_content_pea3_1 Carotene_content_car3_1 Sugar_content_suc3_1
Tomato QTL map

Map: Potato meta-QTL consensus map   
Map version
107 (location: 53171)
Chromosome
3
Position
43.00 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_3 MQTL_2_Late_blight_3 MQTL_3_Late_blight_3
Potato meta-QTL consensus map

Map: Sun1642 x LA1589   
Map version
85 (location: 43831)
Chromosome
3
Position
5.10 cM
Confidence
uncalculated
Protocol
RFLP


Sun1642 x LA1589

Map: Yellow Stuffer x LA1589   
Map version
83 (location: 43582)
Chromosome
3
Position
5.80 cM
Confidence
uncalculated
Protocol
RFLP


Yellow Stuffer x LA1589

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43291)
Chromosome
3
Position
5.60 cM
Confidence
uncalculated
Protocol
RFLP


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Map: Pepper-COSII   
Map version
58 (location: 41624)
Chromosome
3
Position
65.20 cM
Confidence
I
Protocol
RFLP


Pepper-COSII

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40833)
Chromosome
3
Position
5.00 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2008

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39900)
Chromosome
3
Position
33.00 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

Map: Pepper-AC99   
Map version
34 (location: 8672)
Chromosome
3
Position
56.37 cM
Confidence
uncalculated
Protocol
RFLP


Pepper-AC99

Map: Pepper-FAO3   
Map version
31 (location: 8671)
Chromosome
3
Position
48.71 cM
Confidence
uncalculated
Protocol
RFLP


Pepper-FAO3

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8668)
Chromosome
3
Position
30.40 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 8673)
Chromosome
3
Position
10.40 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992
Other PCR data 
PCR data   Exp. ID 35614
Forward primer (5'-3')
CGGAACCCACTTTGTTTTTC
Digested band sizes (using AluI)
Solanum lycopersicum LA925: 500
Solanum pennellii LA716: 400
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCAACCCTGCAAGCTCAAC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1500
Solanum pennellii LA716: 1500
Approximate temperature
55°C
  
PCR data   Exp. ID 40
Forward primer (5'-3')
Unknown
Digested band sizes (using AluI)
Solanum lycopersicum LA925: 500
Solanum pennellii LA716: 400
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
Unknown
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1500
Solanum lycopersicum LA925: 1500
Approximate temperature
55°C
  
Overgo hybridization and physical mapping 
TG130 was used as an overgo probe on plate 2 [well E11]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CTTTGTGTGATGCTGCGTTTTCGG
B sequence
CGTGACGGATTTGAAGCCGAAAAC
AB sequence
CTTTGTGTGATGCTGCGTTTTCGGCTTCAA
Marker sequence
ATTCAGTTAAGCATTTTTACAAACACATAATCTGCAATTTTACATTCTCC
GGTTGGATCGCCGGTTTCCGGTATGGAAACAATCGGCCGGAACCCACTTT
GTTTTTCATCTAAAATTCTTTACACACAATTATAGTTAGATAATTGATAA
ACAAACCCGATATATATAAATTTTATTTTTTTTGGTTGAAATGGCTGACA
TCAATGTTAACTCAGTGTTGACTTCGGGGGAAGATATGGCGGAGAAAGCA
TTGAGCAAGAGATATGAAGGGTTAGTTGCTGTCCGTACAAAAGCTATAAA
AGGGAAAGGAGCTTGGTACTGGGCTCATCTGGAGCCTGTTTTGATTCAAA
ACCCGGAAACGAATCATCCAAAAGCAGTGAAACTTAAGTGCACTTTGTGT
GATGCTGCGTTTTCGGCTTCAAATCCGTCACGGACTGCTACAGAGCATCT
AAAAAGAGGTACTTGTCCCAATTTTGGCGCTGTTTTGAGGCCCATTTCAC
AGTTACCCC
Marker Submitted By 
Name: Molly Jahn
Organization: Cornell University
Genomic location of TG130  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D226 marker 226
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)