SGN Marker solcap_snp_sl_38406

SGN-M22798

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 72585)
Chromosome
1
Position
59.27 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68673)
Chromosome
1
Position
46.35 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65054)
Chromosome
1
Position
72.14 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59129)
Chromosome
1
Position
73.31 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AACTGTGTTACACATGCCTGGGTTTTTGAGACACCAAAGTGGTTGAATCG
  
3' flanking region
TTCAGCACCTATTCCCCTAGAAACCATTCTGTACCTCCATTCATTCAGTC
SNP nucleotide
AG
SNPdb format
AACTGTGTTACACATGCCTGGGTTTTTGAGACACCAAAGTGGTTGAATCG[A/G]
TTCAGCACCTATTCCCCTAGAAACCATTCTGTACCTCCATTCATTCAGTC
  
Genomic location of solcap_snp_sl_38406  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D22798 marker 22798
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)