SGN Marker solcap_snp_sl_38987

SGN-M22885

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 72635)
Chromosome
10
Position
31.14 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68708)
Chromosome
10
Position
42.97 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65090)
Chromosome
10
Position
70.30 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59216)
Chromosome
10
Position
58.20 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ACCCAACACTCCTCACACTATTCTCTCAATTATATTTCTCTTCTAAAGAA
  
3' flanking region
GAAAATGTTTGTCAAGATTGCTTGTTTGGTGGTTTTATGCATGTTGATTA
SNP nucleotide
AT
SNPdb format
ACCCAACACTCCTCACACTATTCTCTCAATTATATTTCTCTTCTAAAGAA[A/T]
GAAAATGTTTGTCAAGATTGCTTGTTTGGTGGTTTTATGCATGTTGATTA
  
Genomic location of solcap_snp_sl_38987  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D22885 marker 22885
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)