Notice: The FTP site is available again. We apologize for any inconvenience.

SGN Marker solcap_snp_sl_41379

SGN-M23204

Synonyms  
SGN-U585791_snp124
SGN-U585791_snp124_solcap_snp_sl_41379
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70480)
Chromosome
3
Position
34.70 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67008)
Chromosome
3
Position
39.70 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63482)
Chromosome
3
Position
41.35 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59535)
Chromosome
3
Position
8.56 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AGAAGATGATCGGAGAGATGGATAACTCCGGTGGGAGATTGAGATCGGAG
  
3' flanking region
TTGATTAGCTCCGGTAGAAGGTCCTCATGGGAGGAAGATGAAAAGGAGTG
SNP nucleotide
AG
SNPdb format
AGAAGATGATCGGAGAGATGGATAACTCCGGTGGGAGATTGAGATCGGAG[A/G]
TTGATTAGCTCCGGTAGAAGGTCCTCATGGGAGGAAGATGAAAAGGAGTG
  
Genomic location of solcap_snp_sl_41379  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23204 marker 23204
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)