Notice: The FTP site is available again. We apologize for any inconvenience.

SGN Marker solcap_snp_sl_42906

SGN-M23335

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 72876)
Chromosome
4
Position
42.36 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68888)
Chromosome
4
Position
53.77 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65262)
Chromosome
4
Position
59.52 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59666)
Chromosome
4
Position
51.71 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CGCTACCATAAACGCCTGCAATTTCAATGCTTCCTTTCCATCACTCACTG
  
3' flanking region
TACCAAAAGGATTTCAAAACTGACAACATTATCTTCAACTATAAAACTCC
SNP nucleotide
TC
SNPdb format
CGCTACCATAAACGCCTGCAATTTCAATGCTTCCTTTCCATCACTCACTG[T/C]
TACCAAAAGGATTTCAAAACTGACAACATTATCTTCAACTATAAAACTCC
  
Genomic location of solcap_snp_sl_42906  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23335 marker 23335
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)