SGN Marker solcap_snp_sl_45301

SGN-M23559

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 72996)
Chromosome
4
Position
1.37 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68964)
Chromosome
4
Position
1.94 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65330)
Chromosome
4
Position
2.70 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59890)
Chromosome
4
Position
0.45 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TATTGTCACATGTCATTTATCGTTATAGTTTGCTGACAAACAGTTGGTCA
  
3' flanking region
CTGGAACAGAAATGAACGCACCAAGGTGTTTGTTTGGCTCTGCCAGCTCT
SNP nucleotide
TG
SNPdb format
TATTGTCACATGTCATTTATCGTTATAGTTTGCTGACAAACAGTTGGTCA[T/G]
CTGGAACAGAAATGAACGCACCAAGGTGTTTGTTTGGCTCTGCCAGCTCT
  
Genomic location of solcap_snp_sl_45301  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23559 marker 23559
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)