SGN Marker solcap_snp_sl_47026

SGN-M23696

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 73082)
Chromosome
4
Position
72.94 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69019)
Chromosome
4
Position
79.40 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65384)
Chromosome
4
Position
118.56 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60027)
Chromosome
4
Position
59.87 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GCAAACAGTTGTATGGGTTGCAAACAGAGAGAAACCACTCACCAATACAT
  
3' flanking region
GTTAGTCGTTTTGAAGGTTAACAAGCGGGGAATACTTGCTCTTCTCAATG
SNP nucleotide
TC
SNPdb format
GCAAACAGTTGTATGGGTTGCAAACAGAGAGAAACCACTCACCAATACAT[T/C]
GTTAGTCGTTTTGAAGGTTAACAAGCGGGGAATACTTGCTCTTCTCAATG
  
Genomic location of solcap_snp_sl_47026  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23696 marker 23696
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)