SGN Marker solcap_snp_sl_47277

SGN-M23709

Synonyms  
CL017321-0298
CL017321-0298_solcap_snp_sl_47277
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60040)
Chromosome
4
Position
61.09 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GACCATACAAGTGGGCGCAGCATCTGGCAGGCATCGATTTTTTACCTGAG
  
3' flanking region
TGTCACCGTCGCTTAGAGGTTTTGAGACTTCAAATGATGAGACATCAAAG
SNP nucleotide
AG
SNPdb format
GACCATACAAGTGGGCGCAGCATCTGGCAGGCATCGATTTTTTACCTGAG[A/G]
TGTCACCGTCGCTTAGAGGTTTTGAGACTTCAAATGATGAGACATCAAAG
  
Genomic location of solcap_snp_sl_47277  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23709 marker 23709
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)