SGN Marker solcap_snp_sl_48338

SGN-M23796

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 73142)
Chromosome
1
Position
118.97 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60127)
Chromosome
1
Position
87.64 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AAGTTAGAAACAGCCGGATTGCCTCGTGAATTACCAGTGATAAATTGGGA
  
3' flanking region
AGCAAATTAGTGTAAGGTCTTGTGTCAACTATTTCTTCAGGATCAATTCC
SNP nucleotide
TG
SNPdb format
AAGTTAGAAACAGCCGGATTGCCTCGTGAATTACCAGTGATAAATTGGGA[T/G]
AGCAAATTAGTGTAAGGTCTTGTGTCAACTATTTCTTCAGGATCAATTCC
  
Genomic location of solcap_snp_sl_48338  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23796 marker 23796
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)