SGN Marker solcap_snp_sl_51380

SGN-M24127

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 73335)
Chromosome
4
Position
39.62 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65562)
Chromosome
4
Position
54.04 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60458)
Chromosome
4
Position
21.17 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AAGAAGTTTGTTTTAGCTAGGAAAGCAGCTGTTTGCTAGGGAAGGATTAC
  
3' flanking region
TGTTGAAGGAATAATTAAGTATTAGTAGTAACTTTTTATTATTAATTTTA
SNP nucleotide
TC
SNPdb format
AAGAAGTTTGTTTTAGCTAGGAAAGCAGCTGTTTGCTAGGGAAGGATTAC[T/C]
TGTTGAAGGAATAATTAAGTATTAGTAGTAACTTTTTATTATTAATTTTA
  
Genomic location of solcap_snp_sl_51380  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24127 marker 24127
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)