SGN Marker solcap_snp_sl_55020

SGN-M24538

Synonyms  
SGN-U564013_snp1820
SGN-U564013_snp1820_solcap_snp_sl_55020
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70376)
Chromosome
3
Position
28.09 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 66907)
Chromosome
3
Position
39.70 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63389)
Chromosome
3
Position
41.35 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60869)
Chromosome
3
Position
7.52 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AAAAGAGAAATACAAGATATCTAGCCAAACAATATACTGATAAGATCAGA
  
3' flanking region
GAGAATACACTTGCGCCATTACTGAAAATCTAGAGGCACTGATATATTCT
SNP nucleotide
AG
SNPdb format
AAAAGAGAAATACAAGATATCTAGCCAAACAATATACTGATAAGATCAGA[A/G]
GAGAATACACTTGCGCCATTACTGAAAATCTAGAGGCACTGATATATTCT
  
Genomic location of solcap_snp_sl_55020  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24538 marker 24538
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)