SGN Marker solcap_snp_sl_59462

SGN-M24984

Synonyms  
CritIso_541
CritIso_541_solcap_snp_sl_59462
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70310)
Chromosome
10
Position
56.25 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 66856)
Chromosome
10
Position
58.85 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61315)
Chromosome
10
Position
62.01 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CCCCCCAACTCAAGCCACAAAGCTGCTGCTGATCAGTACAATTTCCAATT
  
3' flanking region
TCAAAGGGTCAAAACAAGAACTTCTCTGTTTATTGTATCTTGGTTTGCTA
SNP nucleotide
AC
SNPdb format
CCCCCCAACTCAAGCCACAAAGCTGCTGCTGATCAGTACAATTTCCAATT[A/C]
TCAAAGGGTCAAAACAAGAACTTCTCTGTTTATTGTATCTTGGTTTGCTA
  
Genomic location of solcap_snp_sl_59462  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24984 marker 24984
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)