SGN Marker solcap_snp_sl_59801

SGN-M25020

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 73868)
Chromosome
1
Position
40.29 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69559)
Chromosome
1
Position
28.39 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65895)
Chromosome
1
Position
37.56 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61351)
Chromosome
1
Position
5.36 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ATCTGTTGATCTTTCACATTCGGAAGTAACTTTGTAGGGACATGCTCTTA
  
3' flanking region
GTAACAATGAAAAGATTGTTTTCGTGTCCATCGCTGTGAACAATAGGCCT
SNP nucleotide
TC
SNPdb format
ATCTGTTGATCTTTCACATTCGGAAGTAACTTTGTAGGGACATGCTCTTA[T/C]
GTAACAATGAAAAGATTGTTTTCGTGTCCATCGCTGTGAACAATAGGCCT
  
Genomic location of solcap_snp_sl_59801  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D25020 marker 25020
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)