SGN Marker solcap_snp_sl_60745

SGN-M25122

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69608)
Chromosome
10
Position
83.81 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65943)
Chromosome
10
Position
118.59 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61453)
Chromosome
10
Position
64.34 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GCGTAGCTGATTCTGAAGCCAATCAAGCTCGACATGCTGAATCAGCTTAT
  
3' flanking region
CTGAGGTACAAAGCTTAAGGTTAGAACTTATGGAAACACTTGCATTGGCC
SNP nucleotide
AG
SNPdb format
GCGTAGCTGATTCTGAAGCCAATCAAGCTCGACATGCTGAATCAGCTTAT[A/G]
CTGAGGTACAAAGCTTAAGGTTAGAACTTATGGAAACACTTGCATTGGCC
  
Genomic location of solcap_snp_sl_60745  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D25122 marker 25122
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)