SGN Marker solcap_snp_sl_60852

SGN-M25133

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 73943)
Chromosome
10
Position
72.79 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69612)
Chromosome
10
Position
77.17 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61464)
Chromosome
10
Position
63.87 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ACGAAACATGCTATGCTCATTTGAGATGTACATTATACGTTCAAGGGGGT
  
3' flanking region
AAATTTCCTTTTGCTTTTCTCCAGGATAGTGGGAAAGAACTTACAAAGTG
SNP nucleotide
AG
SNPdb format
ACGAAACATGCTATGCTCATTTGAGATGTACATTATACGTTCAAGGGGGT[A/G]
AAATTTCCTTTTGCTTTTCTCCAGGATAGTGGGAAAGAACTTACAAAGTG
  
Genomic location of solcap_snp_sl_60852  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D25133 marker 25133
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)