Notice: The website will be down for maintenance on Aug 18th (Sunday).

SGN Marker solcap_snp_sl_62245

SGN-M25273

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 74018)
Chromosome
3
Position
79.50 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69662)
Chromosome
3
Position
69.02 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65994)
Chromosome
3
Position
72.78 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61604)
Chromosome
3
Position
58.43 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TCTGTCAAGTTCCATTCCGAACTTCTTCGCTATATCAAGATTGAGTGCCA
  
3' flanking region
GATATTCATGGGAAGCAAAAGCAGCAAAAACGAACGTCTACCTTTTTTGA
SNP nucleotide
TC
SNPdb format
TCTGTCAAGTTCCATTCCGAACTTCTTCGCTATATCAAGATTGAGTGCCA[T/C]
GATATTCATGGGAAGCAAAAGCAGCAAAAACGAACGTCTACCTTTTTTGA
  
Genomic location of solcap_snp_sl_62245  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D25273 marker 25273
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)