SGN Marker solcap_snp_sl_62909

SGN-M25344

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 74049)
Chromosome
10
Position
27.30 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69690)
Chromosome
10
Position
36.34 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 66019)
Chromosome
10
Position
49.38 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61675)
Chromosome
10
Position
5.09 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CATATTACTTTCCTCTGTTGATGCTGACACATTCATGGGTTCTTCACTAT
  
3' flanking region
GAAAGAACTAAACGTAGTAGAACTAAAGAAATTCTGCTCTTTGTCCACAA
SNP nucleotide
TG
SNPdb format
CATATTACTTTCCTCTGTTGATGCTGACACATTCATGGGTTCTTCACTAT[T/G]
GAAAGAACTAAACGTAGTAGAACTAAAGAAATTCTGCTCTTTGTCCACAA
  
Genomic location of solcap_snp_sl_62909  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D25344 marker 25344
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)