SGN Marker solcap_snp_sl_63360

SGN-M25386

Synonyms  
CL017347-0326
CL017347-0326_solcap_snp_sl_63360
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61717)
Chromosome
3
Position
1.89 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CATCTGCTCCATTCAAGACTCGGTTTTGCCGCCACAATTTACTGCTTCAT
  
3' flanking region
GTACATTGAATCCTGAACAAGTCGATTCCTCATCGGAATTTGCCTTATCT
SNP nucleotide
AT
SNPdb format
CATCTGCTCCATTCAAGACTCGGTTTTGCCGCCACAATTTACTGCTTCAT[A/T]
GTACATTGAATCCTGAACAAGTCGATTCCTCATCGGAATTTGCCTTATCT
  
Genomic location of solcap_snp_sl_63360  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D25386 marker 25386
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)