Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

SGN Marker solcap_snp_sl_64516

SGN-M25459

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69730)
Chromosome
8
Position
38.02 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 66058)
Chromosome
8
Position
57.75 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61790)
Chromosome
8
Position
56.57 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CTTTATGATCTTATCTCAGAGGATGTTAATTCTTACAAGGATTTGGTGGT
  
3' flanking region
AGCTTTGTAAGCATTCTAAAACAAGTAGCAGAGCGGAGATTGCCCAAGAG
SNP nucleotide
TC
SNPdb format
CTTTATGATCTTATCTCAGAGGATGTTAATTCTTACAAGGATTTGGTGGT[T/C]
AGCTTTGTAAGCATTCTAAAACAAGTAGCAGAGCGGAGATTGCCCAAGAG
  
Genomic location of solcap_snp_sl_64516  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D25459 marker 25459
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)