SGN Marker solcap_snp_sl_65880

SGN-M25528

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69761)
Chromosome
3
Position
50.07 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 66089)
Chromosome
3
Position
54.97 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61859)
Chromosome
3
Position
54.43 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TTCGTTAACACACAACGGTGTTGTTTCAACAAAGAATTTGATATAAACGA
  
3' flanking region
AGTCATTACACGCACCACCTCACCATCATCGGATTTATCACGAACGAACA
SNP nucleotide
CG
SNPdb format
TTCGTTAACACACAACGGTGTTGTTTCAACAAAGAATTTGATATAAACGA[C/G]
AGTCATTACACGCACCACCTCACCATCATCGGATTTATCACGAACGAACA
  
Genomic location of solcap_snp_sl_65880  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D25528 marker 25528
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)