SGN Marker solcap_snp_sl_8855

SGN-M26099

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 74482)
Chromosome
10
Position
68.11 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69994)
Chromosome
10
Position
70.18 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 66311)
Chromosome
10
Position
97.20 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 62430)
Chromosome
10
Position
63.16 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TAATAATCCTCTTCAAATATCTTCAAGTTCGAATCTTTTTGACAGTTCAA
  
3' flanking region
CACAGGGGGTTTCCAAGAAATGATCCAAATGCAATCTCAAAATGTATTTG
SNP nucleotide
TG
SNPdb format
TAATAATCCTCTTCAAATATCTTCAAGTTCGAATCTTTTTGACAGTTCAA[T/G]
CACAGGGGGTTTCCAAGAAATGATCCAAATGCAATCTCAAAATGTATTTG
  
Genomic location of solcap_snp_sl_8855  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D26099 marker 26099
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)