SGN Marker solcap_snp_sl_8858

SGN-M26101

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69996)
Chromosome
10
Position
70.18 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 62432)
Chromosome
10
Position
63.16 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CCAGCTTGAAAAGCAGAGACATTAACGTTTCATTCACCCGTACCCTTTCC
  
3' flanking region
TTTCGTCTCTCCGAATCAACTCCGCCGTTTCGCCGAATAAAAGCTTCCGT
SNP nucleotide
AC
SNPdb format
CCAGCTTGAAAAGCAGAGACATTAACGTTTCATTCACCCGTACCCTTTCC[A/C]
TTTCGTCTCTCCGAATCAACTCCGCCGTTTCGCCGAATAAAAGCTTCCGT
  
Genomic location of solcap_snp_sl_8858  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D26101 marker 26101
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)